Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP

View Paper
ESSAY DETAILS Words: 4724
Pages: 17
(approximately 235 words/page)

Essay Database > Science & Technology > Biology
Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP http://home.coqui.net/myrna/food.htm (10/03/04) SHIGELLA Shigella spp. were the second most common cause of bacterial foodborne illnesses reported by the CDC from 1983 to 1987 and the leading cause in bacterial waterborne outbreaks during 1986 to 1992 in the US. There are four species: Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei. Although this pathogen has been reported in contaminated food and …

showed first 75 words of 4724 total
Sign up for EssayTask and enjoy a huge collection of student essays, term papers and research papers. Improve your grade with our unique database!
showed last 75 words of 4724 total
…the ELISA plate and binds via the biotin-streptavidin interaction. Detection of the bound complex is accomplished via a simple alkaline phosphatase labeled antibody directed against digoxigenin, with color developed using a suitable substrate (Sethabutr et al, 2000). Forward primer H8 GTTCCTTGACCGCCTTTCCGATACCGTC Reverse primer H15 GCCGGTCAGCCACCCTCTGAGAGTAC ( Sethabutr et al., 2000 ) 4. Other Types of Diagnostic Tests: No other tests available here. Updated: 2001 The Hastings & Prince Edward Counties Health Unit http://www.hpechu.on.ca/Topics/InfectiousDiseases/shigella.htm (10/03/04)